|Back to BSS homepage|

Mutations in GPIb beta

Nucleotide sequence and predicted amino acid sequence for the beta chain of human GPIb.
Mutations are highlighted, and described in the corresponding references listed below.

The sequence numbering is according to the GPIb beta sequence of Lopez et al "The alpha and beta chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence." Proc Natl Acad Sci U S A. 1988 Apr;85(7):2135-9. [PubMed] 

                                              -25
     (1)                                       M  G  S  G  P  -21
 -133 C  .............  GCCGGGCTGCCGTCTTCTCGCCATGGGCTCCGGGCCG  37
       
                                        (11)
  R  G  A  L  S  L  L  L  L  L  L  A  P  P  S  R  P  A  A  G   -1
 CGCGGGGCGCTGAGCTTACTGCTCCTGCTGCTGGCCCCGCCGAGCCGCCCGGCCGCAGGT  97

            (10)                                 (6)
  C  P  A  P  C  S  C  A  G  T  L  V  D  C  G  R  R  G  L  T   20
 TGCCCGGCGCCCTGTAGCTGCGCGGGGACGCTCGTGGACTGCGGGCGCCGCGGGCTGACT 157

 (2)                     (7)
  W  A  S  L  P  T  A  F  P  V  D  T  T  E  L  V  L  T  G  N   40
 TGGGCCTCGCTGCCGACCGCCTTCCCTGTCGACACAACCGAGCTGGTGCTGACCGGCAAC 217 
  

  N  L  T  A  L  P  P  G  L  L  D  A  L  P  A  L  R  T  A  H   60
 AACCTGACGGCGCTGCCGCCGGGGCTGCTGGACGCGCTGCCCGCGCTGCGCACCGCACAC 277

          (9)                                             (3)
  L  G  A  N  P  W  R  C  D  C  R  L  V  P  L  R  A  W  L  A   80
 CTGGGCGCCAACCCCTGGCGCTGCGACTGCCGCCTTGTGCCGCTGCGCGCCTGGCTGGCC 337
    
                      (4,5)                   (12)
  G  R  P  E  R  A  P  Y  R  D  L  R  C  V  A  P  P  A  L  R  100
 GGCCGCCCCGAGCGTGCGCCCTACCGCGACCTGCGTTGCGTGGCGCCCCCAGCGCTGCGC 397
     
                      (4)
  G  R  L  L  P  Y  L  A  E  D  E  L  R  A  A  C  A  P  G  P  120
 GGCCGCCTGCTGCCCTATCTGGCCGAGGACGAGCTGCGCGCCGCTTGCGCTCCCGGCCCG 457

  (13,15)(8,13)                  (14)
  L  C  W  G  A  L  A  A  Q  L  A  L  L  G  L  G  L  L  H  A  140
 CTCTGCTGGGGGGCGCTGGCGGCGCAGCTTGCGCTGCTGGGCCTTGGGCTGCTGCACGCG 517

 
  L  L  L  V  L  L  L  C  R  L  R  R  L  R  A  R  A  R  A  R  160
 TTGCTGCTGGTGCTGCTGCTGTGCCGCCTGCGGAGGCTGCGGGCCCGGGCCCGCGCTCGC 577


  A  A  A  R  L  S  L  T  D  P  L  V  A  E  R  A  G  T  D  E  180
 GCCGCAGCCCGGCTGTCGCTGACCGACCCGCTGGTGGCCGAGCGAGCCGGAACCGACGAG 637
    

  S STOP
 TCCTGA

See mutation described in:
  1. mutation: C-133 to G
    Ludlow LB, Schick BP, Budarf ML, Driscoll DA, Zackai EH, Cohen A, Konkle BA. (1996)
    "Identification of a mutation in a GATA binding site of the platelet glycoprotein Ibbeta promoter resulting in the Bernard-Soulier syndrome."[PubMed]
    J Biol Chem. Sep 6;271(36):22076-80.
  2. mutation: G159 to A
    Moran N, Morateck PA, Deering A, Ryan M, Montgomery RR, Fitzgerald DJ, Kenny D.  (2000)
    "The surface expression of glycoprotein Ib alpha is dependent on GPIb beta: Evidence from a novel mutation causing Bernard-Soulier syndrome"
    Blood 96;532-39. [PubMed]
  3. mutation: deletion of C336 or C337
    Dermot Kenny    , Patricia A. Morateck, Joan C. Gill, and Robert R. Montgomery (1999).
    "The Critical Interaction of Glycoprotein (GP) Ib beta With GPIXA Genetic Cause of Bernard-Soulier Syndrome."
    Blood 93: 2968-2975. [PubMed]
  4. mutation: A360 to G and G419 to C 
    Kunishima S    , Lopez JA, Kobayashi S, Imai N, Kamiya T, Saito H, Naoe T. (1997)
    "Missense mutations of the glycoprotein (GP) Ib beta gene impairing the GPIb alpha/beta disulfide linkage in a family with giant platelet disorder."
    Blood. Apr 1;89(7):2404-12. [PubMed]
  5. mutation: A360 to G
    Kurokawa Y et al. (2001)
    "A Missense Mutation (Tyr88 to Cys) in the platelet membrane glycoprotein Ib beta gene affects GPIb/IX complex expression."
    Thromb Haemost 86:1249-56. [PubMed]
  6. mutation: C146 to T (Arg17 to Cys)
    Kunishima S, Naoe T, Kamiya T, Saito H. (2001)
    "Novel heterozygous missense mutation in the platelet glycoprotein Ib beta gene associated with isolated giant platelet disorder."
    Am J Hematol Dec;68(4):249-55. [PubMed]
  7. mutation: C183 to T (Pro29 to Leu)
    A. Hillmann, A. Nurden, P. Nurden, R. Combrié, S. Claeyssens, N. Moran, D. Kenny
    "A novel hemizygous Bernard-Soulier Syndrome (BSS) mutation in the amino terminal domain of Glycoprotein (GP)Ib beta. Platelet characterization and transfection studies."
    Thrombosis and Haemostasis 88;1026-32:2002
  8. mutation: G466 to A (Trp (TGG) to a stop codon (TAG))
    Kunishima S, Matsushita T, Ito T, Kamiya T, Saito H.. (2002)
    "Novel Nonsense mutation in the platelet glycoprotein Ib beta gene associated with Bernard-Soulier Syndrome"
    Am J Hematology 2002 Dec;71(4):279-84 [    PubMed]
  9. mutation: A288 to C (Asn64 to Thr)
    Strassel C, Pasquet JM, Alessi MC, Juhan-Vague I, Chambost H, Combrie R, Nurden P, Bas MJ, De La Salle C, Cazenave JP, Lanza F, Nurden AT. (2003)
    "A Novel Missense Mutation Shows that GPIbbeta Has a Dual Role in Controlling the Processing and Stability of the Platelet GPIb-IX Adhesion Receptor."
    Biochemistry 2003 Apr 22;42(15):4452-62 [    PubMed]
  10. mutation: G14 to A (Cys5 to Tyr)
    Gonzalez-Manchon C, Butta N, Iruin G, Alonso S, Ayuso MS, Parrilla R. (2003)
    "Disruption of the Cys5-Cys7 disulfide bridge in the platelet glycoprotein Ibbeta prevents the normal maturation and surface exposure of GPIb-IX complexes."
    Thromb Haemost. 2003;90(3):456-64. [    PubMed]
  11. mutation: 13 base pair deletion in signal peptide
    Watanabe R, Ishibashi T, Saitoh Y, Shichishima T, Maruyama Y, Enomoto Y, Handa M, Oda A, Ambo H, Murata M, Ikeda Y. (2003)
    "Bernard-soulier syndrome with a homozygous 13 base pair deletion in the signal peptide-coding region of the platelet glycoprotein Ib(beta) gene."
    Blood Coagul Fibrinolysis. 2003;14(4):387-94. [    PubMed]
  12. mutation: C383 to T (Pro96 to Ser)
    Tang J, Stern-Nezer S, Liu PC, Matyakhina L, Riordan M, Luban NL, Steinbach PJ, Kaler SG. (2004)
    "Mutation in the leucine-rich repeat C-flanking region of platelet glycoprotein Ib beta impairs assembly of von Willebrand factor receptor."
    Thromb Haemost. 2004 Jul;92(1):75-88. [    PubMed]
  13. mutation: C122 to S (see also Ref. 8 and Ref. 15)
    Kunisima S, Yamazaki T, Matsushita T, Sako M, Hamaguchi M, Saito H. (2004)
    "Variant Bernard-Soulier syndrome caused by compound heterozygous mutations in the GPIb beta gene."
    Platelets 15:374-75
  14. mutation: C491 to G
    Strassel C, David T, Eckly A, Baas M-J, Moog S, Ravanat C, Trzeciak M-C, Vinciguerra C, Cazenave J-P, Gachet C, Lanza F (2006)
    "Synthesis of GPIbbeta with novel transmembrane and cytoplasmic sequences in a Bernard–Soulier patient resulting in GPIb-defective signaling in CHO cells."
    Journal of Thrombosis and Haemostasis 4:217-228 [    PubMed]
  15. mutation: C122 to S and 443 del G (see also Ref. 13)
    Kunisima S, Sako M, Yamazaki T, Hamaguchi M, Saito H (2006)
    "Molecular genetic analysis of a variant Bernard-Soulier syndrome due to compound heterozygosity for two novel glycoprotein Ibbeta mutations."
    Eur J Haematol. 2006 Nov 2;77(6):501-512. Epub 2006 Sep 15. [    PubMed]

|Back to BSS homepage| Copyright © Royal College of Surgeons in Ireland 2000-2008