|Back to BSS homepage|
Mutations in GPIX
Nucleotide sequence and predicted amino acid sequence for human
GPIX.
Mutations are highlighted, and described in the corresponding references
listed below.
(8)
L F L L W A T A E A -1
CTGTTCCTGCTCTGGGCCACAGCAGAGGCC 15
(1)
T K D C P S P C T C R A L E T 15
ACCAAGGACTGCCCCAGCCCATGTACCTGCCGCGCCCTGGAAACC 60
(2)
M G L W V D C R G H G L T A L 30
ATGGGGCTGTGGGTGGACTGCAGGGGCCACGGACTCACGGCCCTG 105
(2,3,10)
P A L P A R T R H L L L A N N 45
CCTGCCCTGCCGGCCCGCACCCGCCACCTTCTGCTGGCCAACAAC 150
(4)
S L Q S V P P G A F D H L P Q 60
AGCCTTCAGTCCGTGCCCCCGGGAGCCTTTGACCACCTGCCCCAG 195
(5)
L Q T L D V T Q N P W H C D C 75
CTGCAGACCCTCGATGTGACGCAGAACCCCTGGCACTGTGACTGC 240
S L T Y L R L W L E D R T P E 90
AGCCTCACCTATCTGCGCCTCTGGCTGGAGGACCGCACGCCCGAG 285
(6)
A L L Q V R C A S P S L A A H 105
GCCCTGCTGCAGGTCCGCTGTGCCAGCCCCAGCCTCGCTGCCCAT 330
G P L G R L T G Y Q L G S C G 120
GGCCCGCTGGGCCGGCTGACAGGCTACCAGCTGGGCAGCTGTGGC 375
(7)
W Q L Q A S W V R P G V L W D 135
TGGCAGCTGCAGGCGTCCTGGGTGCGCCCGGGGGTCTTGTGGGAC 420
(9)
V A L V A V A A L G L A L L A 150
GTGGCGCTGGTCGCCGTGGCCGCGCTGGGCCTGGCTCTTCTGGCT 465
G L L C A T T E A L D STOP 161
GGCCTGCTGTGTGCCACCACAGAGGCCCTGGATTGA 501
See mutation described in:
-
mutation: T37 to C (Cys to Arg)
Rivera CE, Villagra J, Riordan M, Williams S, Lindstrom KJ,
Rick ME
"Identification of a new mutation in platelet glycoprotein IX (GPIX) in a
patient with Bernard-Soulier syndrome. "
Br J Haem. 2001; 112: 105-8.
[PubMed]
-
mutation: A77 to G (Asp to Gly) and A148 to G (Asn to Ser)
Wright SD, Michaelides K, Johnson DJD, West NC, Tuddenham
EGD
"Double heterozygosity for mutations in the platelet glycoprotein IX gene
in three siblings with Bernard-Soulier syndrome."
Blood. 1993; 81: 2339-2347.
[PubMed]
-
mutation: A148 to G (Asn to Ser)
Clemetson JM, Kyrle PA, Brenner B Clemetson KJ
"Variant Bernard-Soulier syndrome associated with a homozygous mutation in
the leucine-rich domain of glycoprotein IX. "
Blood. 1994; 84: 1124-31.
[PubMed]
-
mutation: T179 to C (Phe to Ser)
Suzuki K, Hayashi T, Yahagi A, Akiba J, Tajima K, Satoh S
"Novel point mutation in the leucine-rich motif of the platelet glycoprotein
IX associated with Bernard-Soulier syndrome."
Br J Haem. 1997; 99: 794-00.
[PubMed]
-
mutation: G233 to A (Cys to Tyr)
Noda M, Fujimura K, Takafuta T, Shimomura T, Fujii T, Katsutani
S, Fujimoto T, Kuramoto A, Yamazaki T, Mochizuki T, Matssuzaki M, Sano M
"A point mutation in glycoprotein IX coding sequence (Cys73{TGT} to Tyr{TAT})
causes impaired surface expression of GPIb/IX/V complex in two families with
Bernard-Soulier syndrome."
Thromb and Haem. 1996; 76: 874-8.
[PubMed]
-
mutation: G305 to A (Cys to Tyr)
Kunishima S, Tomiyama Y, Honda S, Kurata Y, Kamiya T, Ozawa
K, Saito H
"Cys97-Tyr mutation in the glycoprotein IX gene associated with Bernard-Soulier
syndrome."
British Journal of Haematology. 1999; 107: 539-45.
[PubMed]
-
mutation: G396 to A (Trp codon changes to nonsense codon)
Noda M, Fujimura K, Takafuta T, Shimomura T, Fujimoto T,
Yamamoto N, Tanoue K, Arai M, Suehiro A, Kakishita E, Shimasaki A, Kuramoto
A:
"Heterogenous expression of glycoprotein Ib, IX and V in platelets from two
patients with Bernard-Soulier syndrome caused by different genetic
abnormalities."
Thromb and Haem. 1995; 74: 1411-15.
[PubMed]
-
mutation: T-14 to C (Leu-10 to Pro)
Lanza F, De La Salle C, Bass MJ et al
"A Leu7Pro mutation in the signal peptide of platelet glycoprotein (GP)IX in a case of Bernard-Soulier syndrome abolishes surface expression of the GPIb-V-IX complex."
Br J Haematol 2002 Jul;118(1):260-6.
[PubMed]
-
mutation: G to A (Ala-140 to Thr)
Wang Z, Zhao X, Duan W, Fu J, Lu M, Wang G, Bai X, Ruan C.
"A novel mutation in the transmembrane region of glyco-protein IX associated with Bernard-Soulier syndrome."
Thromb Haemost. 2004 Sep;92(3):606-13.
[PubMed]
-
mutation: A148 to G (Asn to Ser), deletion A272 through C280 (Asp, Arg, Thr, Pro to Ala)
Drouin J, Carson NL, Laneuville O.
"Compound heterozygosity for a novel nine-nucleotide deletion and the Asn45Ser missense mutation in the glycoprotein IX gene in a patient with Bernard-Soulier syndrome."
Am J Hematol. 2005 Jan;78(1):41-8.
[PubMed]