|Back to BSS homepage|

Mutations in GPIX

Nucleotide sequence and predicted amino acid sequence for human GPIX.
Mutations are highlighted, and described in the corresponding references listed below.

	        (8)
                 L  F  L  L  W  A  T  A  E  A   -1
                CTGTTCCTGCTCTGGGCCACAGCAGAGGCC  15

                      (1)
  T  K  D  C  P  S  P  C  T  C  R  A  L  E  T   15
 ACCAAGGACTGCCCCAGCCCATGTACCTGCCGCGCCCTGGAAACC  60

                (2)
  M  G  L  W  V  D  C  R  G  H  G  L  T  A  L   30
 ATGGGGCTGTGGGTGGACTGCAGGGGCCACGGACTCACGGCCCTG 105 
    
                                         (2,3,10)
  P  A  L  P  A  R  T  R  H  L  L  L  A  N  N   45 
 CCTGCCCTGCCGGCCCGCACCCGCCACCTTCTGCTGGCCAACAAC 150

                            (4)
  S  L  Q  S  V  P  P  G  A  F  D  H  L  P  Q   60  
 AGCCTTCAGTCCGTGCCCCCGGGAGCCTTTGACCACCTGCCCCAG 195 

                                     (5)
  L  Q  T  L  D  V  T  Q  N  P  W  H  C  D  C   75
 CTGCAGACCCTCGATGTGACGCAGAACCCCTGGCACTGTGACTGC 240 


  S  L  T  Y  L  R  L  W  L  E  D  R  T  P  E   90
 AGCCTCACCTATCTGCGCCTCTGGCTGGAGGACCGCACGCCCGAG 285

                   (6)
  A  L  L  Q  V  R  C  A  S  P  S  L  A  A  H  105
 GCCCTGCTGCAGGTCCGCTGTGCCAGCCCCAGCCTCGCTGCCCAT 330


  G  P  L  G  R  L  T  G  Y  Q  L  G  S  C  G  120
 GGCCCGCTGGGCCGGCTGACAGGCTACCAGCTGGGCAGCTGTGGC 375
    
                   (7)
  W  Q  L  Q  A  S  W  V  R  P  G  V  L  W  D  135
 TGGCAGCTGCAGGCGTCCTGGGTGCGCCCGGGGGTCTTGTGGGAC 420

             (9)
  V  A  L  V  A  V  A  A  L  G  L  A  L  L  A  150
 GTGGCGCTGGTCGCCGTGGCCGCGCTGGGCCTGGCTCTTCTGGCT 465


  G  L  L  C  A  T  T  E  A  L  D STOP 161
 GGCCTGCTGTGTGCCACCACAGAGGCCCTGGATTGA 501   


See mutation described in:
  1. mutation: T37 to C (Cys to Arg)
    Rivera CE, Villagra J, Riordan M, Williams S, Lindstrom KJ, Rick ME
    "Identification of a new mutation in platelet glycoprotein IX (GPIX) in a patient with Bernard-Soulier syndrome. "
    Br J Haem. 2001; 112: 105-8. [PubMed]
  2. mutation:  A77 to G (Asp to Gly) and A148 to G (Asn to Ser)
    Wright SD, Michaelides K, Johnson DJD, West NC, Tuddenham EGD
    "Double heterozygosity for mutations in the platelet glycoprotein IX gene in three siblings with Bernard-Soulier syndrome."
    Blood. 1993; 81: 2339-2347. [PubMed]
  3. mutation: A148 to G (Asn to Ser)
    Clemetson JM, Kyrle PA, Brenner B Clemetson KJ
    "Variant Bernard-Soulier syndrome associated with a homozygous mutation in the leucine-rich domain of glycoprotein IX. "
    Blood. 1994; 84: 1124-31. [PubMed]
  4. mutation: T179 to C (Phe to Ser)
    Suzuki K, Hayashi T, Yahagi A, Akiba J, Tajima K, Satoh S
    "Novel point mutation in the leucine-rich motif of the platelet glycoprotein IX associated with Bernard-Soulier syndrome."
    Br J Haem. 1997; 99: 794-00. [PubMed]
  5. mutation: G233 to A (Cys to Tyr)
    Noda M, Fujimura K, Takafuta T, Shimomura T, Fujii T, Katsutani S, Fujimoto T, Kuramoto A, Yamazaki T, Mochizuki T, Matssuzaki M, Sano M
    "A point mutation in glycoprotein IX coding sequence (Cys73{TGT} to Tyr{TAT}) causes impaired surface expression of GPIb/IX/V complex in two families with Bernard-Soulier syndrome."
    Thromb and Haem. 1996; 76: 874-8. [PubMed]
  6. mutation: G305 to A (Cys to Tyr)
    Kunishima S, Tomiyama Y, Honda S, Kurata Y, Kamiya T, Ozawa K, Saito H
    "Cys97-Tyr mutation in the glycoprotein IX gene associated with Bernard-Soulier syndrome."
    British Journal of Haematology. 1999; 107: 539-45. [PubMed]
  7. mutation: G396 to A (Trp codon changes to nonsense codon)
    Noda M, Fujimura K, Takafuta T, Shimomura T, Fujimoto T, Yamamoto N, Tanoue K, Arai M, Suehiro A, Kakishita E, Shimasaki A, Kuramoto A:
    "Heterogenous expression of glycoprotein Ib, IX and V in platelets from two patients with Bernard-Soulier syndrome caused by different genetic abnormalities."
    Thromb and Haem. 1995; 74: 1411-15. [PubMed]
  8. mutation: T-14 to C (Leu-10 to Pro)
    Lanza F, De La Salle C, Bass MJ et al
    "A Leu7Pro mutation in the signal peptide of platelet glycoprotein (GP)IX in a case of Bernard-Soulier syndrome abolishes surface expression of the GPIb-V-IX complex."
    Br J Haematol 2002 Jul;118(1):260-6. [PubMed]
  9. mutation: G to A (Ala-140 to Thr)
    Wang Z, Zhao X, Duan W, Fu J, Lu M, Wang G, Bai X, Ruan C.
    "A novel mutation in the transmembrane region of glyco-protein IX associated with Bernard-Soulier syndrome."
    Thromb Haemost. 2004 Sep;92(3):606-13. [PubMed]
  10. mutation: A148 to G (Asn to Ser), deletion A272 through C280 (Asp, Arg, Thr, Pro to Ala)
    Drouin J, Carson NL, Laneuville O.
    "Compound heterozygosity for a novel nine-nucleotide deletion and the Asn45Ser missense mutation in the glycoprotein IX gene in a patient with Bernard-Soulier syndrome."
    Am J Hematol. 2005 Jan;78(1):41-8. [PubMed]


|Back to BSS homepage| Copyright © Royal College of Surgeons in Ireland 2000-2008