|Back to BSS homepage|

Mutations in GPIb alpha

Nucleotide sequence and predicted amino acid sequence for human GPIb alpha.
Mutations are highlighted, and described in the corresponding references listed below.

The sequence numbering is according to the GPIb alpha sequence of Lopez et al "Cloning of the alpha chain of human platelet glycoprotein Ib: a transmembrane protein with homology to leucine-rich alpha 2-glycoprotein." Proc Natl Acad Sci U S A. 1987 Aug;84(16):5615-9. [PubMed] 

                                            M  P  L  L  L  L  L  L  L  L  P  S  P  L  H  P    -1 
 GACGCTCTGTGCCTTCGGAGGTCTTTCTGCCTGCCTGTCCTCATGCCTCTCCTCCTCTTGCTGCTCCTGCTGCCAAGCCCCTTACACCCC   90
   
                                                      (13)
  H  P  I  C  E  V  S  K  V  A  S  H  L  E  V  N  C  D  K  R  N  L  T  A  L  P  P  D  L  P    30
 CACCCCATCTGTGAGGTCTCCAAAGTGGCCAGCCACCTAGAAGTGAACTGTGACAAGAGGAATCTGACAGCGCTGCCTCCAGACCTGCCG  180

                                                                               (8)
  K  D  T  T  I  L  H  L  S  E  N  L  L  Y  T  F  S  L  A  T  L  M  P  Y  T  R  L  T  Q  L    60
 AAAGACACAACCATCCTCCACCTGAGTGAGAACCTCCTGTACACCTTCTCCCTGGCAACCCTGATGCCTTACACTCGCCTCACTCAGCTG  270 

             (17)                            (10)
  N  L  D  R  C  E  L  T  K  L  Q  V  D  G  T  L  P  V  L  G  T  L  D  L  S  H  N  Q  L  Q   120
 AACCTAGATAGGTGCGAGCTCACCAAGCTCCAGGTCGATGGGACGCTGCCAGTGCTGGGGACCCTGGATCTATCCCACAATCAGCTGCAA  360

 
  S  L  P  L  L  G  Q  T  L  P  A  L  T  V  L  D  V  S  F  N  R  L  T  S  L  P  L  G  A  L   120
 AGCCTGCCCTTGCTAGGGCAGACACTGCCTGCTCTCACCGTCCTGGACGTCTCCTTCAACCGGCTGACCTCGCTGCCTCTTGGTGCCCTG  450
     
                       (1;16;19)
  R  G  L  G  E  L  Q  E  L  Y  L  K  G  N  E  L  K  T  L  P  P  G  L  L  T  P  T  P  K  L   150
 CGTGGTCTTGGCGAACTCCAAGAGCTCTACCTGAAAGGCAATGAGCTGAAGACCCTGCCCCCAGGGCTCCTGACGCCCACACCCAAGCTG  540

               (4;18)                                           (18)                (11)
  E  K  L  S  L  A  N  N  N  L  T  E  L  P  A  G  L  L  N  G  L  E  N  L  D  T  L  L  L  Q   180
 GAGAAGCTCAGTCTGGCTAACAACAACTTGACTGAGCTCCCCGCTGGGCTCCTGAATGGGCTGGAGAATCTCGACACCCTTCTCCTCCAA  630
    
                                                                               (23)  (5)
  E  N  S  L  Y  T  I  P  K  G  F  F  G  S  H  L  L  P  F  A  F  L  H  G  N  P  W  L  C  N   210
 GAGAACTCGCTGTATACAATACCAAAGGGCTTTTTTGGGTCCCACCTCCTGCCTTTTGCTTTTCTCCACGGGAACCCCTGGTTATGCAAC  720
     
                                                                                    (15)
  C  E  I  L  Y  F  R  R  W  L  Q  D  N  A  E  N  V  Y  V  W  K  Q  G  V  D  V  K  A  M  T   240
 TGTGAGATCCTCTATTTTCGTCGCTGGCTGCAGGACAATGCTGAAAATGTCTACGTATGGAAGCAAGGTGTGGACGTCAAGGCCATGACC  810

 
  S  N  V  A  S  V  Q  C  D  N  S  D  K  F  P  V  Y  K  Y  P  G  K  G  C  P  T  L  G  D  E   270
 TCTAACGTGGCCAGTGTGCAGTGTGACAATTCAGACAAGTTTCCCGTCTACAAATACCCAGGAAAGGGGTGCCCCACCCTTGGTGATGAA  900

                                                                        (14)
  G  D  T  D  L  Y  D  Y  Y  P  E  E  D  T  E  G  D  K  V  R  A  T  R  T  V  V  K  F  P  T   300
 GGTGACACAGACCTATATGATTACTACCCAGAAGAGGACACTGAGGGCGATAAGGTGCGTGCCACAAGGACTGTGGTCAAGTTCCCCACC  990
     
   (22)
  K  A  H  T  T  P  W  G  L  F  Y  S  W  S  T  A  S  L  D  S  Q  M  P  S  S  L  H  P  T  Q   330
 AAAGCCCATACAACCCCCTGGGGTCTATTCTACTCATGGTCCACTGCTTCTCTAGACAGCCAAATGCCCTCCTCCTTGCATCCAACACAA 1080

                                     (6)
  E  S  T  K  E  Q  T  T  F  P  P  R  W  T  P  N  F  T  L  H  M  E  S  I  T  F  S  K  T  P   360
 GAATCCACTAAGGAGCAGACCACATTCCCACCTAGATGGACCCCAAATTTCACACTTCACATGGAATCCATCACATTCTCCAAAACTCCA 1170

 
  M  E  S  I  T  F  S  K  T  P  T  T  S  E  P  V  P  E  P  A  P  N  M  T  T  L  E  P  T  P   390
 AAATCCACTACTGAACCAACCCCAAGCCCGACCACCTCAGAGCCCGTCCCGGAGCCCGCCCCAAACATGACCACCCTGGAGCCCACTCCA 1260

         
  S  P  T  T  P  E  P  T  S  E  P  A  P  S  P  T  T  P  E  P  T  P  I  P  T  I  A  T  S  P   420
 AGCCCGACCACCCCAGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCCGGAGCCCACCCCAATCCCGACCATCGCCACAAGCCCG 1350

                                                                  (14)(9)             (12;14;20)
  T  I  L  V  S  A  T  S  L  I  T  P  K  S  T  F  L  T  T  T  K  P  V  S  L  L  E  S  T  K   450
 ACCATCCTGGTGTCTGCCACAAGCCTGATCACTCCAAAAAGCACATTTTTAACTACCACAAAACCCGTATCACTCTTAGAATCCACCAAA 1440

(12;14;20)
  K  T  I  P  E  L  D  Q  P  P  K  L  R  G  V  L  Q  G  H  L  E  S  S  R  N  D  P  F  L  H   480
 AAAACCATCCCTGAACTTGATCAGCCACCAAAGCTCCGTGGGGTGCTCCAAGGGCATTTGGAGAGCTCCAGAAATGACCCTTTTCTCCAC 1530

                                (2;3;19;22)           (7;17)
  P  D  F  C  C  L  L  P  L  G  F  Y  V  L  G  L  F  W  L  L  F  A  S  V  V  L  I  L  L  L   510
 CCCGACTTTTGCTGCCTCCTCCCCCTGGGCTTCTATGTCTTGGGTCTCTTCTGGCTGCTCTTTGCCTCTGTGGTCCTCATCCTGCTGCTG 1620


  S  W  V  G  H  V  K  P  Q  A  L  D  S  G  Q  G  A  A  L  T  T  A  T  Q  T  T  H  L  E  L   540
 AGCTGGGTTGGGCATGTGAAACCACAGGCCCTGGACTCTGGCCAAGGTGCTGCTCTGACCACAGCCACACAAACCACACACCTGGAGCTG 1710


  Q  R  G  R  Q  V  T  V  P  R  A  W  L  L  F  L  R  G  S  L  P  T  F  R  S  S  L  F  L  W   570
 CAGAGGGGACGGCAAGTGACAGTGCCCCGGGCCTGGCTGCTCTTCCTTCGAGGTTCGCTTCCCACTTTCCGCTCCAGCCTCTTCCTGTGG 1800


  V  R  P  N  G  R  V  G  P  L  V  A  G  R  R  P  S  A  L  S  Q  G  R  G  Q  D  L  L  S  T   600
 GTACGGCCTAATGGCCGTGTGGGGCCTCTAGTGGCAGGAAGGAGGCCCTCAGCTCTGAGTCAGGGTCGTGGTCAGGACCTGCTGAGCACA 1890


  V  S  I  R  Y  S  G  H  S  L STOP  
 GTGAGCATTAGGTACTCTGGCCACAGCCTCTGA

See mutation described in:
  1. mutation: T476 to C (Leu129 to Pro)
    Li C, Martin E Roth GJ
    "The genetic defect in two well-studied cases of Bernard-Soulier Syndrome: A point mutation in the fifth leucine-rich repeat of platelet glycoprotein Ib alpha."
    Blood. 1995; 86: 3805-14. [PubMed]
  2. mutation: deletion of A and T of the codon for Tyr492
    Kenny D, Newman PJ, Morateck PA Montgomery RR:
    "A dinucleotide deletion in glycoprotein Ib alpha results in defective membrane anchoring and circulating soluble glycoprotein Iba in a novel form of Bernard-Soulier syndrome."
    Blood. 1997; 90: 2626-33. [PubMed]
  3. mutation: deletion of A and T of the codon for Tyr492
    Afshar-Kharghan V López JA
    "Bernard-Soulier syndrome caused by a dinucleotide deletion and reading frame shift in the region encoding the glycoprotein Ib alpha transmembrane domain."
    Blood. 1997; 90: 2634-43. [PubMed]
  4. mutation: C557 to T (Ala156 to Val)
    Ware J, Russell SR, Marchese P, Murata M, Mazzucato M, Marco LD Ruggeri ZM
    "Point mutation in a leucine-rich repeat of platelet glycoprotein Ib alpha resulting in the Bernard-Soulier syndrome."
    J Clin Invest. 1993; 92: 1213-1220. [PubMed]
  5. mutation: T715 to A (Cys209 to Ser)
    Simsek S, Noris P, Lozano M, Pico M, von dem Borne AEG, Ribera A Gallardo D
    "Cys209 Ser mutation in the platelet membrane glycoprotein Ib alpha gene is associated with Bernard-Soulier syndrome."
    Br J Haem. 1994; 88: 839-844. [PubMed]
  6. mutation: G1119 to A (Trp codon (TGG) changes to nonsense codon (TGA))
    Ware J, Russell SR, Vicente V, Scharf RE, Tomer A, McMillan R Ruggeri ZM
    "Nonsense mutation in the glycoprotein Ib alpha coding sequence associated with Bernard-Soulier syndrome."
    Proc Natl Acad Sci. 1990; 87: 2026-2030. [PubMed]
  7. mutation: G1584 to A (Trp 498 to Stop) 
    Holmberg L, Karpman D, Nilsson I Olofsson T
    "Bernard-Soulier syndrome Karlstad: Trp 498g Stop mutation resulting in a truncated glycoprotein Ib alpha that contains part of the transmembranous domain."
    British Journal of Haem. 1997; 98: 57-63. [PubMed]
  8. mutation: C259 to T (Leu57 to Phe)
    Miller JL, Lyle VA Cunningham D
    "Mutation of leucine-57 to phenylalanine in a platelet glycoprotin Ib alpha leucine tandem repeat occuring in patients with an autosomal dominant variant of Bernard-Soulier disease."
    Blood. 1992; 79: 439-446. [PubMed]
  9. mutation: C1421 to A (Ser444 to Stop)
    Kunishima S, Miura H, Fukutani H, Yoshida H, Osumi K, Kobayashi S, Ohno R Naoe T
    "Bernard-Soulier Syndrome Kagoshima: Ser 444gStop Mutation of Glycoprotein (GP) Ib alpha resulting in circulating truncated GPIB alpha and surface expresson of GPIb beta and GPIX."
    Blood. 1994; 84: 3356-3362. [PubMed]
  10. mutation: deletion of T317 (Leu76 to Arg); deletion causes a shift in the reading frame, predicting a premature stop codon after 19 altered amino-acids.
    Simsek S, Admiraal LG, Modderman PW, van der Schoot CE von dem Borne AEG
    "Identification of a homozygous single base pair deletion in the gene coding for the human platelet glycoprotein Ib alpha causing Bernard-Soulier syndrome."
    Thromb and Haem. 1994; 72: 444-9. [PubMed]
  11. mutation: Leu179 deletion
    de la Salle C, Baas M, Lanza F, Schwartz A, Hanau D, Chevalier J, Gachet C, Briquel M Cazenave J
    "A three-base deletion removing a leucine residue in a leucine-rich repeat of platelet glycoprotein Ib alpha associated with a variant of Bernard-Soulier syndrome (Nancy 1)."
    Br J Haem. 1995; 89: 386-396. [PubMed]
  12. mutation: nucleotide deletion of A within A1438 to A1444
    Noda M, Fujimura K, Takafuta T, Shimomura T, Fujimoto T, Yamamoto N, Tanoue K, Arai M, Suehiro A, Kakishita E, Shimasaki A Kuramoto A
    "Heterogenous expression of glycoprotein Ib, IX and V in platelets from two patients with Bernard-Soulier syndrome caused by different genetic abnormalities."
    Thromb and Haem. 1995; 74: 1411-15. [PubMed]
  13. mutation: deletion of A in codon 19 (leads to a frame shift in codons 19-21 and a premature stop codon after codon 21)
    Li C, Pasquale DN Roth GJ
    "Bernard-Soulier syndrome with severe bleeding: absent platelet glycoprotein Ib alpha due to a homozygous one-base deletion."
    Thromb Haem. 1996; 76: 670-4. [PubMed]
  14. mutation:
    Case 1 - dinucleotide deletion within the TGTG repeat at nucleotides 972 to 975
    Case 2 - an insertion of a single base (T) at nucleotide 1,418 in one allele, and a deletion of a single base (A) within the 7-adenine repeat at nucleotides 1,438 to 1,444 in another allele
    Kanaji T, Okamura T, Kuroiwa M, Noda M, Fujimura K, Kuramoto A, Sano M, Nakano S Niho Y
    "Molecular and genetic analysis of two patients with Bernard-Soulier syndrome - identification of new mutations in glycoprotein Ib alpha gene."
    Thromb Haemost. 1997; 77: 1055-61. [PubMed]
  15. mutation: A805 to G (Met239 to Val)
    Takahashi H, Murata M, Moriki T, Anbo H, Furukawa T, Nikkuni K, Shibata A, Handa M, Kawai Y, Watanabe K Ikeda Y
    "Substitution of Val for Met at residue 239 of platelet glycoprotein Ib alpha in  Japanese patients with platelet-type von Willebrand disease."
    Blood. 1995; 85: 727-33. [PubMed]
  16. mutation: T476 to C (Leu129 to Pro)
    Antonucci JV, Martin ES, Hulick PJ, Joseph A Martin SE
    "Bernard-Soulier syndrome: common ancestry in two african american families with the GPIb alpha Leu129Pro mutation."
    Am J Hematol. 2000; 65: 141-148. [PubMed]
  17. mutation: T283 to C (Cys65 to Arg); G1584 to A (Trp 498 to Stop)
    Kenny D, Jónsson OG, Morateck PA Montgomery RR
    "Naturally occurring mutations in glycoprotein Ib alpha that result in defective ligand binding and synthesis of a truncated protein."
    Blood. 1998; 92: 175-83. [PubMed]
  18. mutation: deletion of aminoacids from residue 169 to 180 (deletion of 36 nucleotides); 
    C557 to T (Ala156 to Val); Glu181 to Lys
    Margaglione M, D'Andrea G, Grandone E, Brancaccio V, Amoriello A Di Minno G
    "Compound heterozygosity (554-589) del, C515-T transition) in the platelet glycoprotein Ib alpha gene in a patient with a severe bleeding tendency."
    Thrombosis & Haemostasis. 1999; 81: 486-92. [PubMed]
  19. mutation:
    Case 1: deletion of A and T of the codon for Tyr492 and T476 to C (Leu129 to Pro)
    Case 2: deletion of A and T of the codon for Tyr492
    Koskela S, Partanen J, Salmi TT Kekoaki R
    "Molecular characterisation of two mutations in platelet glycoprotein Ib alpha in two Finnish Bernard-Soulier syndrome families."
    European Journal of Haematology. 1999; 62: 160-8. [PubMed]
  20. mutation: nucleotide deletion of A within A1438 to A1444
    Mitsui T, Yokoyama S, Yazaki N, Hayashi T, Suzuki K, Shimizu Y, Kawakami T, Kanazawa C, Katsuura M, Ikegami T Kayasaka K
    "Severe bleeding tendency in a patient with Bernard-Soulier syndrome associated with a homozygous single base pair deletion in the gene coding for the human platelet glcoprotein Ib alpha."
    Journal of Pediatric hematology/Oncology. 1998; 20: 246-51. [PubMed]
  21. mutation: C557 to T (Ala156 to Val)
    Savoia A, Balduini CL, Savino M, Noris P, Del Vecchio M, Perrotta S, Belletti S, Poggi V Iolascon A
    "Autosomal dominant macrothrombocytopenia in Italy is most frequently a type of heterozygous Bernard-Soulier syndrome."
    Blood. 2001; 97: 1330-1335. [PubMed]
  22. mutation: deletion of G994 (Ala302 to Pro); deletion of A and T of the codon for Tyr492 (see also reference 2).
    A novel compound heterozygous case in a 12 year old girl from Wisconsin.
    RR Montgomery1, D Kenny1, CA Diamond2.
    1Blood Center of Southeastern Wisconsin. 2 Dept. of Pediatric Hematology, University of Wisconsin Children's Hospital.
  23. mutation: T709 to G (Trp207 to Gly)
    Rosenburg N, Lalezari S, Landau M, Shenkman B, Seligsohn U, Izraeli S.
    "Trp207Gly in platelet glycoprotein Ibalpha is a novel mutation which disrupts the connection between the leucine-rich repeat domain and the disulfide loop structure and causes Bernard-Soulier syndrome."
    J Thromb Haemost. 2007;5:378-86 [PubMed]

|Back to BSS homepage| Copyright © Royal College of Surgeons in Ireland 2000-2008